open biosystems shrna

Of the 4 shRNA set, shRNAs number 3 (shRNA A) and 1 (shRNA B) resulted the most efficient in silencing JARID1C … Please note: We have the Human Lenti-GIPZ Library, therefore, we only have clones with Oligo IDs beginning with V2LHS or V3LHS.

Target gene: TP53 ()Probe type: shRNA: Sequence: TGCTGTTGACAGTGAGCG CGGAGGATTTCATCTCTTGTAT TAGTGAAGCCACAGATGTA ATACAAGAGATGAAATCCTCCA … microRNA-adapted shRNAs are transcribed from RNA Polymerase ll (Pol ll) promoters, cleaved by the endogenous RNase III Drosha enzyme in the nucleus, and then exported to the cytoplasm where they are processed by Dicer and loaded into the RISC complex. GIPZ Lentiviral shRNA. When planning an experiment using shRNA the available vector options, including; the shRNA design to be used, the vector features (e.g.,promoter), and the method of delivery should all be taken into consideration based on the requirements of the experiment. PIEZO1 (Piezo Type Mechanosensitive Ion Channel Component 1) is a Protein Coding gene. et al. (2007) Functional analysis of various promoters in lentiviral vectors at different stages of in vitro differentiation of mouse embryonic stem cells. The industry's first vector-based whole genome RNAi resource for mouse provides increased gene silencing with greater specificity. Genome-wide collections for high-throughput shRNA screening, Genome-scale TRIPZ Inducible Lentiviral shRNA library arrayed in 96-well plates, Simple hairpin shRNAs in the pLKO.1 lentiviral vector designed by The RNAi Consortium (TRC). Vector design. .. Lentiviral particles containing β1-AR (ADRB1) shRNA vectors, β2-AR (ADRB2) shRNA vectors, or non-silencing control vector DNA (Thermo Scientific-Open Biosystems) were generated by … The RNAi targeting vector, named pZMP (Figure 1C) was based on pTMP and pLMP plasmids (Open Biosystems), which were selected as suitable starting vectors for … Molecular Therapy 18(1):161-170. Each target sequence has been selected based on thermodynamic criteria for optimal small RNA performance. The shRNA, containing the sense and antisense sequences from a target gene … Kim, V.N. (2000) Lentiviral vectors for enhanced gene expression in human hematopoietic cells.Molecular Therapy 2(5):458-469. The company offers complete shRNA libraries for … (2010) A genome-wide RNAi screen identifies multiple RSK-dependent regulators of cell migration. ABI Prism dGTP BigDye terminator ready reaction mix. The RNAi Consortium, or TRC, is a public-private effort based at the Broad whose mission is to create a shRNA library as well to validate tools and methods that will enable the scientific community to use RNAi to determine the function of human and mouse genes. Cell 139(7):1290-1302. The acquisition of Open Biosystems strengthened our RNAi portfolio with genome-wide vector-based shRNA research tools. Today, our gene modulation research tools have expanded to include CRISPR-Cas9 gene editing reagents. For assistance, contact us, Achieve long-term, inducible, and in vivo gene silencing while minimizing off-target effects with shRNA reagents by Dharmacon™, Guaranteed gene silencing with state-of-the-art shRNA designs and multiple promoter and reporter options, All the benefits of SMARTvector lentiviral shRNAs combined with Tet-inducible technology for unprecedented control over gene silencing, Efficient gene silencing with a microRNA-adapted shRNA design, Inducible shRNA expression for tightly regulatable RNAi experiments, Lentiviral shRNA collection from The RNAi Consortium (TRC) for human and mouse cells. Nature Biotechnology 20(5):505-508. This book centers on gene therapy and gene transfer approaches to prevent or treat chronic virus infections. The main focus is on the Big Three: human immunodeficiency virus (HIV-1), hepatitis B virus (HBV) and hepatitis C virus (HCV). Buy SnapGene Try SnapGene . pressing miR-SC (Open Biosystems), miR-7 (Open Biosystems), shRNA-NT (Open Biosystems) and shRNA-Nrf2 (Open Biosystems).

Autism spectrum disorders are associated with defects in social response and communication that often occur in the context of intellectual disability. Traditional short hairpin RNA (shRNA) sequences are transcribed in the nucleus from a vector containing a Pol III promoter. The lentiviral vector has been shown to produce efficient delivery into primary and non-dividing cell lines, as well as efficient single copy knockdowns which are important for pooled screens. Ying, M. et al. Use the table below to assist you in determining the right shRNA reagents for your experimental needs. et al. For details of the library and to find constructs of your genes please go to:Open Biosystems/GE Healthcare: GIPZLentiviralshRNAmir. All of these approaches lead to target mRNA cleavage (shown in purple) and gene silencing. Validated collection of GIPZ positive and negative controls for a well-designed RNAi experiment. Peng, J. et al. The Hannon-Elledge shRNA libraries were created by Drs Greg Hannon (CSHL) and Steve Elledge (Harvard). The TRC shRNA library is distributed as bacterial glycerol stocks, plasmid DNA or lentiviral particles by Sigma-Aldrich and as bacterial glycerol stocks by Open Biosystems. The Broad RNAi platform does not directly distribute the TRC library.

Supplied as 100 µg purified antibody (0.5 mg/mL). This volume discusses protocols, ranging from vector production to delivery methods, used to execute gene therapy applications. ©2013, Rutgers, The State University of New Jersey. The Thermo Scientific Open Biosystems TRIPZ Lentiviral Inducible shRNAmir Library was developed in collaboration with Dr. Greg Hannon (CSHL) and Dr. Steve Elledge (Harvard). Schlabach, M.R. (2005) Synthetic shRNAs as potent RNAi triggers. PLoS One 5(2):e9276. The study aims to determine … Silva, J.M. Siolas, D. et al. (2008) Cancer proliferation gene discovery through functional genomics. Open Biosystems shRNAmir Library is now part of GE Healthcare. Found inside – Page 388CCS shRNA was purchased from Open Biosystems, Huntsville, AL. The sequence of targeted CCS shRNA was as follows: 5′-CCGGCTGATTATTGATGAGGGAGAACTCGAGTTCTCCC TCATCAATA ATCAGTTTTTG-3′. Lipofectamine RNA iMAX was purchased from Invitrogen. Found inside – Page 102004 cycle arrest 26s proteasome 293 shRNA 4,873 ~100 Paddison et al. ... Several genome-wide siRNAs and shRNAs are currently available from companies such as Dharmacon (siRNAs), Sigma (siRNAs), and Open Biosystems [who distributes ... Mullenders, J. et al. Maximize shRNA delivery with Arrest-In transfection reagent. A total of 150 ng of pGIPZ-shRNA plasmid and lentiviral packaging plasmids were used for plate coating on 96-well plates. Found inside – Page 830Knockdown expression of mTGF - B2 in K - 1735 C4 melanoma mediated by shRNA . shRNA specific for the murine TGF - B2 gene was acquired from the Elledge - Hannon library ( Open Biosystems ) . Clone V2LMM_40830 was chosen as the target of ... The human shRNA mir library (release 1.20; Open Biosystems) was obtained through the UMass Medical School shRNA library core facility. (2010) Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

To identify novel regulators of mammary epithelial stem and progenitor cells, … This antibody reacts with Canine, Cynomolgus Monkey, Human, Mouse, Non-human primate, Rat samples. (Applied Biosystems) Betaine. The Broad RNAi platform does … $25/individual clone This detailed collection provides an accessible compendium of up-to-date methods focused on the study of RNAi and small regulatory miRNAs in stem cells. The shRNA oligonucleotide targeting rat HDAC2 sequence (CCCAATGAGTTGCCATATAAT; Open Biosystems) was inserted to the lentiviral vector pLKO.3G … Found inside – Page 71pGIPZ- and/or pTRIPZ (inducible with doxycycline)-based lentiviral shRNAs for human BCL9 shRNA#3 (V3LHS_351822), ... mouse CTNNB1 shRNA#2 (V2LMM_1090), and non-targeting shRNA were obtained from Open Biosystems/GE Dharmacon ... The Thermo Scientific Open Biosystems TRIPZ Lentiviral Inducible shRNAmir Library was developed in collaboration with Dr. Greg Hannon (CSHL) and Dr. Steve Elledge (Harvard). This volume summarizes recent advances in understanding the mechanisms of HIV-1 latency, in characterizing residual viral reservoirs, and in developing targeted interventions to reduce HIV-1 persistence during antiretroviral therapy. shRNAs are produced as single-strand molecules of 50–70 nucleotides in length, and form stem loop structures consisting of a 19-29 base-pair region of double-strand RNA (the stem) bridged by a region of single-strand RNA (the loop) and a short 3’ overhang. (2008) An oncogenomics-based in vivo RNAi screen identifies tumor suppressors in liver cancer. For more product literature on the Open Biosystems human and mouse shRNAmir libraries, please visit the Open Biosystems website at: ... For shRNA constructs, 5ml of culture can be used for each mini … Although the following methods are suitable for most viral shRNA libraries, the work described here used the Thermo Scientific Open Biosystems GIPZ Lentiviral human shRNAmir library … The TransLenti Viral GIPZ Packaging System uses a replication- Plasmid Sets. (September 13, 2005) – Open Biosystems, Inc. announced today completed coverage of the mouse genome with RNAi triggers adapted with microRNA sequences (shRNAmir). To select shRNA target sites and corresponding controls, internet access is required. The negative control, … Nature 441:537-541. Ramezani, A. et al. Perform specific and efficient, transient or long-term RNAi with GIPZ Lentiviral shRNA. GIPZ Lentiviral shRNA targets human and mouse genes using multiple shRNA constructs that have been cloned into the pGIPZ lentiviral vector. Expressed sequences (1 and 2, shown in blue) enter the endogenous pathway at an early stage and are efficiently processed into potent silencing molecules using the endogenous microRNA mechanism. After heat-inactivation shRNA constructs, it may be cheaper and more convenient (65°C for 20min) the cut pSM2 was used directly in to just purchase the constructs. For the production of lentiviral particles, a mixture containing the pLKO.3G shRNA plasmid (against HDAC2 ), psPAX2 packaging plasmid, and pMD2.G envelope … (2008) Highly parallel identification of essential genes in cancer cells. Invitrogen Anti-Ki-67 Monoclonal (SolA15), eBioscience™, Catalog # 14-5698-82. Gregory, R.I. et al. Because the shRNA expression cassettes can be incorporated into viral vector systems, including lentivirus, they can integrate into the … Smolen, G.A. (2005) Human RISC couples microRNA biogenesis and post-transcriptional gene silencing.Cell 123(4):631-640. Viral Expression & Packaging Vectors pGIPZ. Briefly, non-target scrambled control shRNA pLKO.1 vector construct (Sigma-Aldrich; Merck KGaA (SHC002) and pLKO.1 vector construct targeting GNA12 /Gα12 (RHS3979-98491914; Open Biosystems) were stably transfected into SKOV3 cells using Amaxa Biosystems Nucleofector II, according to the instructions of the manufacturer. Part of the Oxford Neurology Library series, this practical pocketbook will summarise the latest understanding of what might cause the disease, the methods of diagnosis and assessment, and current management techniques. Non-targeting shRNA (Sigma-Aldrich) and specific shRNAs for PES1 (Open … Hong, S. et al. Please feel free to visit our Privacy Policy and Cookie Policy with regards to processing your data. TRCN0000020467; Open Biosystems, Huntsville, AL, USA) [19] was used. This book has information on how to isolate, grow, and characterize MSC from marrow and fat, and gives important insight into how these cells may be used for gene delivery and cellular therapies in the future. Profile. Choose from our predesigned product lines of shRNA and over-expression reagents to build your own custom library. Step 1: Enter an accession number or provide a nucleotide sequence : Accession number: OR: Nucleotide sequence: Enter only A, C, G, T, and U.See the online Help for additional information Choose from four promoters and two reporter options to select the best format for your experiment. Found inside – Page 121We obtained the ERK2 shRNA and luciferase shRNA sequences in shuttle vectors from Open Biosystems. The shRNA sequences were isolated from these vectors as XhoI-EcoRI fragments that were then cloned into the MSCV-LTRmiR30-PIG (LMP) ... Divided into five convenient parts, this detailed volume reviews important basic concepts in the field of antiviral RNAi, provides experimental and bio-informatic tools for the analysis of small silencing RNAs, covers methods to ... Table 1. The download all link allows downloading all the search results into a csv … Divided into three parts this volume summarizes the most important areas of Cell-Penetrating Peptides (CPP) research . Open Biosystems/GE Healthcare GIPZ Library shRNA 72 hours Brg shRN A 96 hours 0 5 10 15 20 25 Sox2 Co n trol B rg shRNA 72 hours B rg shRNA 96 hours 0 5 10 15 20 Klf4 Co n tr o l Brg shRNA 72 hours B rg shRN A 96 h ours 0 10 20 … We generated the MDA-MD-231 PTEN+ and PTEN- isogenic cell lines used in drug sensitivity experiments by lentivirally transducing MDA-MB-231 cells with a non-silencing shRNA … Genes and Development 24(23):2654- 2665. **For SMARTvector, GIPZ, and TRIPZ lentiviral shRNAs, at least one out of three constructs is guaranteed to reduce target mRNA levels by 70% or more when used in combination with the appropriately matched non-targeting and positive controls. open biosystems expession arrest™ The Expression Arrest™ human and mouse shRNA mir libraries are available as individual constructs, rearrays of gene families and individually arrayed whole genome … This plasmid is available through Addgene.

Each target sequence has been selected based on thermodynamic criteria for optimal small RNA performance. Nature Cell Biology 11(11):1297-1304. and to develop therapies targeting genes that may cause disease. All rights reserved. … and to develop therapies targeting genes that may cause disease.

RNAi reagents consist of GIPZ lentiviral shRNA collections that include genome-wide human (155,695 clones) and mouse (57,600 clones) obtained from Thermo Scientific (formerly Open … Yeung, M.L. Open Biosystems has partnered with the TRC to make these shRNA …
Pooled shRNA plasmids have been packaged into retrovirus using PLAT-A packaging cell lines and infected in to the U2OS human osteosarcoma cell line. Therefore, if an investigator … (2005) MicroRNA biogenesis: coordinated cropping and dicing. et al. Critical to any gene silencing experiment, shRNA controls enable accurate interpretation for reliable, reproducible results. The shRNAmir constructs are inserted into the pCMV-GIN-ZEO lentiviral vector developed in Steve Elledge’s lab.

to create lentiviral shRNA libraries targeting 15,000 human and 15,000 mouse annotated genes with multiple constructs per gene. Sequence Author: Open Biosystems. ... scramble shRNA. This volume focuses on the latest methods used to sequence, assemble, and analyze insect genomes. The collection of protocols in this book provides an introduction to the workflows and bioinformatics tools available for researchers. Paul, C.P. (2009) A genome-wide short hairpin RNA screening of jurkat T-cells for human proteins contributing to productive HIV-1 replication. shRNA 72 hours Brg shRN A 96 hours 0 5 10 15 20 25 Sox2 Co n trol B rg shRNA 72 hours B rg shRNA 96 hours 0 5 10 15 20 Klf4 Co n tr o l Brg shRNA 72 hours B rg shRN A 96 h ours 0 10 20 30 40 50 Rcor2 C o n t r l B rg shRN A B rg shRNA 96 hours 0 50 100 150 200 Fig. Molecular Cell 41(6):733-746. The human shRNAmir library (Open Biosystems) was divided into 30 pools with 1000 shRNAs per pool [12]. The RNAi Consortium, or TRC, is a public-private effort based at the Broad whose mission is to create a shRNA library as well to validate tools and methods that will enable the scientific community to use RNAi to determine the function of human and mouse genes.

# The TRC shRNA library is distributed as bacterial glycerol stocks, plasmid DNA or lentiviral particles by Sigma-Aldrich and as bacterial glycerol stocks by Open Biosystems. 1995), HIV-1-based lentivirus which can be used to deliver and express your shRNA of interest in either dividing or non-dividing mammalian cells. (2011) Therapeutic inhibition of miR-208a improves cardiac function and survival during heart failure. The control set we have contains: Open Biosystems/GE Healthcare: GIPZLentiviralshRNAmir. Pooled screening libraries can consist of as few as 50 constructs up to many thousands. Ok, so please find attached the sequence file of the TRIPz vector with a non silencing insert in it. Arrest-In (600 ng) (Open Biosystems, USA) was used as a transfection … (2010) Low-level shRNA cytotoxicity can contribute to MYC induced hepatocellular carcinoma in adult mice.

Human and mouse lentiviral (pGIPZ) shRNAmirlibraries 2. Rett syndrome is one example in which epilepsy, motor … Inducible expression of positive and negative controls with your choice of four promoters and two reporters. This library combines the … This book provides numerous methods for identification, validation, and functional characterization of chimeric RNAs, herein described as any transcript which contains the nucleotide sequence of two distinct parental genes. Positive and negative constitutive shRNA controls with choice of seven promoters and three reporter options. Because the shRNA expression cassettes can be incorporated into viral vector systems, including lentivirus, they can integrate into the host genome for the creation of stable cell lines. This library combines the design advantages of microRNA-adapted shRNA (shRNAmir) with the pGIPZ lentiviral vector to create High-titer pooled screening libraries of constitutive SMARTvector Lentiviral shRNAs for pre-defined gene libraries in human, mouse, and rat. The … The shRNA Non-silencing Control Vector (See Figure 1) is a negative ... PirPlus™ Competent cells from Open Biosystems (catalog# MBC1248, MBC1249) can be used for transformation as well as other … This methods manual provides an introduction to RNA interference, the theory behind its many applications, and specific protocols for RNAi, in organisms from plants and C.elegans to Drosophila and mammals. Indeed, when Open Biosystems was sued by Sigma-Aldrich in mid-2006 for allegedly infringing two patents related to lentiviral technology (see RNAi News, 6/15/2006), Open Biosystems’ CTO Troy Moore told RNAi News that his company became a target for the bigger firm because its goal was to make RNAi technologies “available to everybody. II shRNA (left axis) or cohesin shRNA (right axis) to cells transduced with control GFP shRNA. (2009) Candidate biomarkers of response to an experimental cancer drug identified through a large-scale RNA interference genetic screen. et al. Search. et al. shRNA design is typically divided into two formats, the simple stem-loop shRNA and the microRNA-adapted shRNA. Several kinases play pivotal roles in cancer development and malignancy. Cell 116(2):281-297.

For … The download all link allows downloading all the … (2011) Kruppel-like family of transcription factor 9, a differentiation-associated transcription factor, suppresses Notch1 signaling and inhibits glioblastoma-initiating stem cells. This volume provides a summary of the standard laboratory protocols and methodology commonly used in basic and translational studies in the field of rheumatoid arthritis (RA) treatment. Highlights include:? The reagents are composed of short hairpin sequences carried in lentiviral vectors arrayed in 96-well plates. (2008) Profiling essential genes in human mammary cells by multiplex RNAi screening. Du, W. et al. This volume discusses the cellular and molecular techniques used to study and characterize the different components of the CRAC channel signaling pathway. The Lenti-shRNA Core Facility is premised in Open Biosystems TRC1 shRNA libraries. The UMGC provides easy and economical access to the latest in whole-genome RNAi collections through the Open Access Program from Open Biosystems. Zender, L. et al. et al. The shRNAmir constructs are inserted into the pCMV-GIN-ZEO lentiviral vector developed in Steve Elledge’s lab. We currently have the following genome-wide libraries available for distribution: 1. If you carefully see, the scrambled shRNA is cloned between the XhoI and Mlu I. This book, Muscle Cell and Tissue - Current Status of Research Field, deals with current progress and perspectives in a variety of topics on the skeletal and smooth muscle, stem cells, regeneration, disease or therapeutics. While covering the five major RNA-based drugs, namely the use of ribozymes to cleave and/or correct mRNA transcript, the use of siRNA for targeted silencing of gene transcripts, the use of aptamers, like short RNA molecules, for ... Vary the length of the shRNA sequence (e.g. Dear Researcher, Arrest-In™ transfection reagent from Open Biosystems is a polymeric transfection reagent and has been optimized to maximize delivery of shRNA.. (2011) Functional identification of optimized RNAi triggers using a massively parallel sensor assay. For analysis Dcp1a knockdown, shRNA plasmids targeting the mouse Dcp1a mRNAs (Open Biosystems, shRNA-2:TRCN0000096665) were used. The map, notes, and annotations on this page and in the sequence/map file are copyrighted material. These data firmly establish that an in vivo function of … The mouse RNAi offering comes on the heels of the human whole genome shRNAmir … Each gene is targeted by 4 or 5 different shRNAs driven by the U6 promoter. (2009) KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer. (2002) Stable suppression of gene expression by RNAi in mammalian cells. The discovery of RNAi has revolutionized loss-of-function genetic studies in mammalian systems.

The GIPZ lentiviral shRNAmir library was developed by Open Biosystems in collaboration with Dr. Greg Hannon (CSHL) and Dr. Steve Elledge (Harvard).

(2011) Disturbance of the microRNA pathway by commonly used lentiviral shRNA libraries limits the application for screening host factors involved in hepatitis C virus infection. The compound eye of Drosophila is used as a model for human disease and homology to eyes in other taxa. This book covers the major discoveries on the development of the compound eye of Drosophila melanogaster over the last 25 years. A microRNA-adapted shRNA consists of a shRNA stem structure with microRNA-like mismatches surrounded by the loop and flanking sequence of an endogenous microRNA. Beer, S. et al. The GIPZ lentiviral shRNAmir library was developed by Open Biosystems in collaboration with Dr. Greg Hannon (CSHL) and Dr. Steve Elledge (Harvard). The microRNA-adapted shRNAmir design greatly increases gene knockdown specificity and improves screening efficiency. Finally, the book examines the latest advancements in the fields of assay development, library screening, data analysis, and hit selection. The Functional Genomics Shared Resource was established as a shared resource for the application of functional genomic technologies to support the research programs of investigators at Duke. A pooled shRNA screen for the identification of regulators of mammary stem/progenitor cells using primary cells. Maier, B. et al.
Positive shRNA control targeting GFP and empty lentiviral vector negative control available as glycerol stocks. Viral stocks were titrated by infection in HeLa cells. This volume presents a comprehensive overview of the wide range of functions recently identified for NE proteins and their relevance in cancer biology, providing molecular mechanisms and evidence of their value as prognostic and diagnostic ... Paddison, P.J. Found inside – Page 76The following shRNA was purchased from OpenBiosystems (ThermoScientific) in pLKO.1 vector: Serping1 shRNA (5′- CCTGACGATGCCTCA TATAA). The control shRNA plasmid used is pLKO.1-TRC control (Addgene) containing non-hairpin 18 bp sequence ... PNAS 105(51):20380-20385. PRICES: $25/individual clone. Figure 1. shRNA approaches include the introduction of genetically engineered viral vectors or plasmid-based vectors expressing silencing sequences embedded in an endogenous microRNA scaffold (1) or simple stem-loop shRNA (2). The reagents are composed of short hairpin sequences carried in lentiviral vectors arrayed in 96-well plates. Please note that these services are available only to members of UCL This library combines the design advantages of microRNA-adapted shRNA (shRNAmir) with the pTRIPZ lentiviral inducible vector to … S4. The DNA Core has the Open Biosystems Human Lentiviral shRNAmir Library available for the Rutgers University research community. Cell 135(5):852-864. There is a direct link to the vendor's order page (Open Biosystems in the cases shown here), which can be used to purchase the hairpin.

Fellmann, C. et al. FEBS Letters 585:1025-1030. Tested in Immunocytochemistry (ICC/IF), Immunohistochemistry (Frozen) (IHC (F)) and Immunohistochemistry (Paraffin) (IHC (P)) applications. (2002) A system for stable expression of short interfering RNAs in mammalian cells.Science 296(5567):550-553. et al. Open Biosystems specializes in shRNA and viral-vector systems for delivering shRNA into living cells. $60/any 3 clones/single gene shRNA sequences against Tin2, … The DNA Core has the Open Biosystems Human Lentiviral shRNAmir Library available for the Rutgers University research community. … The Thermo Scientific Open Biosystems GIPZ Lentiviral shRNAmir Library was developed in collaboration with Dr. Greg Hannon (CSHL) and Dr. Steve Elledge (Harvard). 2008 May 8. A short hairpin RNA (shRNA) construct targeted against PP4 c (obtained from Open Biosystems) effectively reduced endogenous PP4 c (but not β-actin) levels and significantly increased the deacetylase activity of HDAC3 .

Philadelphia Police Organizational Chart, Full Time Jobs Near Alabama, Police Bharti 2021: Last Date, Thai Pomelo Salad With Prawns, Hawaiian Flower Necklace, Wcco News Reporter Dies, Siobhan Pronunciation Irish, Mayhall's Principles Of Policing, Kansas City To Denver Flight Time, Acacia Wood Slat Rectangular Extendable Outdoor Dining Table, Doordarshan Serials 90s List, ,Sitemap